Review



shscramble vector  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Addgene inc shscramble vector
    In vivo validation of adavosertib and vincristine (VCR) in LFS SHH-MB models (A) Survival of mice injected with BT084 patient-derived xenograft (PDX) model during treatment with adavosertib and VCR; log rank test was used for statistical analysis. (B) Tumor growth dynamics of BT084 PDX model during treatment with adavosertib and vincristine (VCR): data are represented as mean ± SEM. (C) Phospho (p)-CDK1 in LFS SHH-MB PDX cells (HS231222 and LFS primary) following in vivo treatment with adavosertib and VCR: numbers below the blot represent normalized fold change relative to non-treated control. (D) Tumor growth dynamics of LFS MB PDX models expressing WEE1 shRNA (shWEE1) and control shRNA <t>(shSCRAMBLE).</t> (E) Survival of mice injected with LFS MB PDX models expressing shWEE1 and shSCRAMBLE; log rank test was used for statistical analysis.
    Shscramble Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1060 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shscramble vector/product/Addgene inc
    Average 96 stars, based on 1060 article reviews
    shscramble vector - by Bioz Stars, 2026-05
    96/100 stars

    Images

    1) Product Images from "Preclinical drug screen identifies WEE1 inhibitor and vinca alkaloid as a combination treatment concept for Li-Fraumeni syndrome medulloblastoma"

    Article Title: Preclinical drug screen identifies WEE1 inhibitor and vinca alkaloid as a combination treatment concept for Li-Fraumeni syndrome medulloblastoma

    Journal: iScience

    doi: 10.1016/j.isci.2025.114564

    In vivo validation of adavosertib and vincristine (VCR) in LFS SHH-MB models (A) Survival of mice injected with BT084 patient-derived xenograft (PDX) model during treatment with adavosertib and VCR; log rank test was used for statistical analysis. (B) Tumor growth dynamics of BT084 PDX model during treatment with adavosertib and vincristine (VCR): data are represented as mean ± SEM. (C) Phospho (p)-CDK1 in LFS SHH-MB PDX cells (HS231222 and LFS primary) following in vivo treatment with adavosertib and VCR: numbers below the blot represent normalized fold change relative to non-treated control. (D) Tumor growth dynamics of LFS MB PDX models expressing WEE1 shRNA (shWEE1) and control shRNA (shSCRAMBLE). (E) Survival of mice injected with LFS MB PDX models expressing shWEE1 and shSCRAMBLE; log rank test was used for statistical analysis.
    Figure Legend Snippet: In vivo validation of adavosertib and vincristine (VCR) in LFS SHH-MB models (A) Survival of mice injected with BT084 patient-derived xenograft (PDX) model during treatment with adavosertib and VCR; log rank test was used for statistical analysis. (B) Tumor growth dynamics of BT084 PDX model during treatment with adavosertib and vincristine (VCR): data are represented as mean ± SEM. (C) Phospho (p)-CDK1 in LFS SHH-MB PDX cells (HS231222 and LFS primary) following in vivo treatment with adavosertib and VCR: numbers below the blot represent normalized fold change relative to non-treated control. (D) Tumor growth dynamics of LFS MB PDX models expressing WEE1 shRNA (shWEE1) and control shRNA (shSCRAMBLE). (E) Survival of mice injected with LFS MB PDX models expressing shWEE1 and shSCRAMBLE; log rank test was used for statistical analysis.

    Techniques Used: In Vivo, Biomarker Discovery, Injection, Derivative Assay, Control, Expressing, shRNA



    Similar Products

    96
    Addgene inc shscramble vector
    In vivo validation of adavosertib and vincristine (VCR) in LFS SHH-MB models (A) Survival of mice injected with BT084 patient-derived xenograft (PDX) model during treatment with adavosertib and VCR; log rank test was used for statistical analysis. (B) Tumor growth dynamics of BT084 PDX model during treatment with adavosertib and vincristine (VCR): data are represented as mean ± SEM. (C) Phospho (p)-CDK1 in LFS SHH-MB PDX cells (HS231222 and LFS primary) following in vivo treatment with adavosertib and VCR: numbers below the blot represent normalized fold change relative to non-treated control. (D) Tumor growth dynamics of LFS MB PDX models expressing WEE1 shRNA (shWEE1) and control shRNA <t>(shSCRAMBLE).</t> (E) Survival of mice injected with LFS MB PDX models expressing shWEE1 and shSCRAMBLE; log rank test was used for statistical analysis.
    Shscramble Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shscramble vector/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    shscramble vector - by Bioz Stars, 2026-05
    96/100 stars
      Buy from Supplier

    93
    OriGene shscramble sequence as control
    (A-B) Tumor spheroid invasion in collagen I matrix after (A) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or (B) treatment with MEL23. Representative images above and quantification below of area invaded and number of cells invading 24 h after implantation. (C-D) Tumor spheroid invasion in collagen I-BME matrix after (C) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or (D) treatment with MEL23. Representative images and quantification of area invaded 24 h after implantation. (E) Representative images of cell morphology of HT1080 p53KO cells transfected with siRNAs against Mdm2 or siCtrl in collagen matrix, 6 h after implantation. (F) Quantification of more circular cells (circularity of 0.75 or higher) in each condition shown in (E). (G-I) HT1080 p53KO cells stably expressing shRNA scramble <t>(shScramble)</t> or a pool of shRNAs against Mdm2 (shMdm2) were used to analyze metastatic burden using mouse models. (G) Protein levels of Mdm2 and MdmX in HT1080 shScramble and shMdm2 stable cell lines. β-actin was used as loading control. (H) Representative images above and quantification below of metastatic foci in the lungs after implantation of shScramble or shMdm2 cells using orthotropic model. (I) Representative images above and quantification below of metastatic foci in the lungs after injection of shScramble or shMdm2 cells using tail-vein model. Scale bars equivalent to 200 µm. Experiments shown represent mean ±SD of at least 3 biological replicates, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.
    Shscramble Sequence As Control, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shscramble sequence as control/product/OriGene
    Average 93 stars, based on 1 article reviews
    shscramble sequence as control - by Bioz Stars, 2026-05
    93/100 stars
      Buy from Supplier

    90
    Shanghai GenePharma lentiviral vectors shscramble
    (A-B) Tumor spheroid invasion in collagen I matrix after (A) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or (B) treatment with MEL23. Representative images above and quantification below of area invaded and number of cells invading 24 h after implantation. (C-D) Tumor spheroid invasion in collagen I-BME matrix after (C) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or (D) treatment with MEL23. Representative images and quantification of area invaded 24 h after implantation. (E) Representative images of cell morphology of HT1080 p53KO cells transfected with siRNAs against Mdm2 or siCtrl in collagen matrix, 6 h after implantation. (F) Quantification of more circular cells (circularity of 0.75 or higher) in each condition shown in (E). (G-I) HT1080 p53KO cells stably expressing shRNA scramble <t>(shScramble)</t> or a pool of shRNAs against Mdm2 (shMdm2) were used to analyze metastatic burden using mouse models. (G) Protein levels of Mdm2 and MdmX in HT1080 shScramble and shMdm2 stable cell lines. β-actin was used as loading control. (H) Representative images above and quantification below of metastatic foci in the lungs after implantation of shScramble or shMdm2 cells using orthotropic model. (I) Representative images above and quantification below of metastatic foci in the lungs after injection of shScramble or shMdm2 cells using tail-vein model. Scale bars equivalent to 200 µm. Experiments shown represent mean ±SD of at least 3 biological replicates, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.
    Lentiviral Vectors Shscramble, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vectors shscramble/product/Shanghai GenePharma
    Average 90 stars, based on 1 article reviews
    lentiviral vectors shscramble - by Bioz Stars, 2026-05
    90/100 stars
      Buy from Supplier

    90
    VectorBuilder GmbH lentiviral vectors encoding shrnas that were scrambled (shscramble) (i.e., sham) or to plin2 (shplin2)
    (A-B) Tumor spheroid invasion in collagen I matrix after (A) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or (B) treatment with MEL23. Representative images above and quantification below of area invaded and number of cells invading 24 h after implantation. (C-D) Tumor spheroid invasion in collagen I-BME matrix after (C) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or (D) treatment with MEL23. Representative images and quantification of area invaded 24 h after implantation. (E) Representative images of cell morphology of HT1080 p53KO cells transfected with siRNAs against Mdm2 or siCtrl in collagen matrix, 6 h after implantation. (F) Quantification of more circular cells (circularity of 0.75 or higher) in each condition shown in (E). (G-I) HT1080 p53KO cells stably expressing shRNA scramble <t>(shScramble)</t> or a pool of shRNAs against Mdm2 (shMdm2) were used to analyze metastatic burden using mouse models. (G) Protein levels of Mdm2 and MdmX in HT1080 shScramble and shMdm2 stable cell lines. β-actin was used as loading control. (H) Representative images above and quantification below of metastatic foci in the lungs after implantation of shScramble or shMdm2 cells using orthotropic model. (I) Representative images above and quantification below of metastatic foci in the lungs after injection of shScramble or shMdm2 cells using tail-vein model. Scale bars equivalent to 200 µm. Experiments shown represent mean ±SD of at least 3 biological replicates, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.
    Lentiviral Vectors Encoding Shrnas That Were Scrambled (Shscramble) (I.E., Sham) Or To Plin2 (Shplin2), supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vectors encoding shrnas that were scrambled (shscramble) (i.e., sham) or to plin2 (shplin2)/product/VectorBuilder GmbH
    Average 90 stars, based on 1 article reviews
    lentiviral vectors encoding shrnas that were scrambled (shscramble) (i.e., sham) or to plin2 (shplin2) - by Bioz Stars, 2026-05
    90/100 stars
      Buy from Supplier

    94
    OriGene mel cellsc shpcbp1 cggcgtgccgcagtccgtcaccgagtgtg shpcbp2 ggcctataccattcaaggacagtatgcca shscramble tr30013 af
    (A-B) Tumor spheroid invasion in collagen I matrix after (A) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or (B) treatment with MEL23. Representative images above and quantification below of area invaded and number of cells invading 24 h after implantation. (C-D) Tumor spheroid invasion in collagen I-BME matrix after (C) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or (D) treatment with MEL23. Representative images and quantification of area invaded 24 h after implantation. (E) Representative images of cell morphology of HT1080 p53KO cells transfected with siRNAs against Mdm2 or siCtrl in collagen matrix, 6 h after implantation. (F) Quantification of more circular cells (circularity of 0.75 or higher) in each condition shown in (E). (G-I) HT1080 p53KO cells stably expressing shRNA scramble <t>(shScramble)</t> or a pool of shRNAs against Mdm2 (shMdm2) were used to analyze metastatic burden using mouse models. (G) Protein levels of Mdm2 and MdmX in HT1080 shScramble and shMdm2 stable cell lines. β-actin was used as loading control. (H) Representative images above and quantification below of metastatic foci in the lungs after implantation of shScramble or shMdm2 cells using orthotropic model. (I) Representative images above and quantification below of metastatic foci in the lungs after injection of shScramble or shMdm2 cells using tail-vein model. Scale bars equivalent to 200 µm. Experiments shown represent mean ±SD of at least 3 biological replicates, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.
    Mel Cellsc Shpcbp1 Cggcgtgccgcagtccgtcaccgagtgtg Shpcbp2 Ggcctataccattcaaggacagtatgcca Shscramble Tr30013 Af, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mel cellsc shpcbp1 cggcgtgccgcagtccgtcaccgagtgtg shpcbp2 ggcctataccattcaaggacagtatgcca shscramble tr30013 af/product/OriGene
    Average 94 stars, based on 1 article reviews
    mel cellsc shpcbp1 cggcgtgccgcagtccgtcaccgagtgtg shpcbp2 ggcctataccattcaaggacagtatgcca shscramble tr30013 af - by Bioz Stars, 2026-05
    94/100 stars
      Buy from Supplier

    93
    Addgene inc lentiviral vectors plko 1
    (A-B) Tumor spheroid invasion in collagen I matrix after (A) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or (B) treatment with MEL23. Representative images above and quantification below of area invaded and number of cells invading 24 h after implantation. (C-D) Tumor spheroid invasion in collagen I-BME matrix after (C) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or (D) treatment with MEL23. Representative images and quantification of area invaded 24 h after implantation. (E) Representative images of cell morphology of HT1080 p53KO cells transfected with siRNAs against Mdm2 or siCtrl in collagen matrix, 6 h after implantation. (F) Quantification of more circular cells (circularity of 0.75 or higher) in each condition shown in (E). (G-I) HT1080 p53KO cells stably expressing shRNA scramble <t>(shScramble)</t> or a pool of shRNAs against Mdm2 (shMdm2) were used to analyze metastatic burden using mouse models. (G) Protein levels of Mdm2 and MdmX in HT1080 shScramble and shMdm2 stable cell lines. β-actin was used as loading control. (H) Representative images above and quantification below of metastatic foci in the lungs after implantation of shScramble or shMdm2 cells using orthotropic model. (I) Representative images above and quantification below of metastatic foci in the lungs after injection of shScramble or shMdm2 cells using tail-vein model. Scale bars equivalent to 200 µm. Experiments shown represent mean ±SD of at least 3 biological replicates, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.
    Lentiviral Vectors Plko 1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vectors plko 1/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    lentiviral vectors plko 1 - by Bioz Stars, 2026-05
    93/100 stars
      Buy from Supplier

    90
    Millipore non-target shrna control vector (shscramble, shc016)
    (A) The level of trapped PARP1 in HeLa cells treated with or without Talazoparib (10 μM for 72 hrs). Top, chromatin-bound fractions were isolated and were probed using the indicated antibodies. Histone H3 was used as the loading control. Bottom, the graph shows the quantification of the level of PARP1 trapping. Values were presented as means ± SD from three biological replicates. Significance was determined with unpaired Student’s t-test. ***p < 0.001. (B) Staining of cytosolic dsDNA in HeLa cells treated with or without Talazoparib (10 μM for 72 hrs). Left, representative image of PicoGreen (green) staining. DAPI (blue) was used to visualize the nucleus. Scale bars represent 10 μm. Right, the graph shows the quantification of the number of cells with cytosolic dsDNA. Values were presented as means ± SEM from three biological replicates (n = 3 fields, ≥ 100 cells counted per condition). Significance was *** determined with unpaired Student’s t-test. p < 0.0001. (C) The extent of DNA damage in HeLa cells treated with or without Talazoparib (10 μM for 72 hrs). Top, whole cell lysates were probed using the indicated antibodies. Bottom, the graph shows the quantification of γH2AX levels. Values were presented as means ± SD from three biological replicates. Significance was determined with unpaired Student’s t-test. **p < 0.01. (D) The level of pS172 TBK1 in HeLa cells treated with or without Talazoparib (10 μM for 72 hrs). Top, whole cell lysates were probed using the indicated antibodies. Bottom, the graph shows the quantification of pS172 TBK1 levels. Values were presented as means ± SD from three biological replicates. Significance was determined with unpaired Student’s t-test. **p < 0.01. (E) The level of pS396 IRF3 in HeLa cells treated with or without Talazoparib (10 μM for 72 hrs). Left, representative image of pS396 IRF3 levels (green). DAPI (blue) was used to visualize the nucleus. Scale bars represent 20 μm. Right, the graph shows the quantification of the number of cells stained positive for pS396 IRF3 in nucleus. Values were presented as means ± SEM from three biological replicates (n = 3 fields, ≥ 100 cells counted per condition). Significance was determined with unpaired Student’s t-test. ***p < 0.001. (F) RT-qPCR of type I interferons levels in HeLa cells treated with or without Talazoparib (10 μM for 72 hrs). Values of Inf-α and Inf-β were presented as means ± SEM from three biological replicates. Significance was determined with unpaired Student’s t-test. *p < 0.05, **p < 0.01. (G) Knock-down <t>of</t> <t>cGAS.</t> HeLa cells expressing the control <t>shRNA</t> (shScramble) or shcGAS (shcGAS #1 or #2) were probed using the indicated antibodies. Right, the graph shows the ratio of cGAS depletion. Values were presented as means ± SD from three biological replicates. Significance was determined with one-way ANOVA. ***p < 0.001. (H) Depletion of cGAS abolishes PARPi-induced activation of innate immune signaling. HeLa cells expressing shRNA against control (shScramble) or cGAS (shcGAS #1 or #2) were treated with or without Talazoparib (10 μM for 72 hrs). The cells were lysed and were immunoblotted using the indicated antibodies. Values were presented as means ± SD from three biological replicates. Significance was determined with two-way ANOVA. ****p < 0.0001, n.s., not significant. (I) RT-qPCR analyses of type I interferons. HeLa cells expressing shRNA against control (shScramble) or cGAS (shcGAS #1 or #2) were treated with or without Talazoparib (10 μM for 72 hrs). Values of Inf-α and Inf-β mRNA levels were presented as means ± SEM from three biological replicates. Significance was determined with unpaired Student’s t-test. ****p < 0.0001, n.s., not significant.
    Non Target Shrna Control Vector (Shscramble, Shc016), supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/non-target shrna control vector (shscramble, shc016)/product/Millipore
    Average 90 stars, based on 1 article reviews
    non-target shrna control vector (shscramble, shc016) - by Bioz Stars, 2026-05
    90/100 stars
      Buy from Supplier

    Image Search Results


    In vivo validation of adavosertib and vincristine (VCR) in LFS SHH-MB models (A) Survival of mice injected with BT084 patient-derived xenograft (PDX) model during treatment with adavosertib and VCR; log rank test was used for statistical analysis. (B) Tumor growth dynamics of BT084 PDX model during treatment with adavosertib and vincristine (VCR): data are represented as mean ± SEM. (C) Phospho (p)-CDK1 in LFS SHH-MB PDX cells (HS231222 and LFS primary) following in vivo treatment with adavosertib and VCR: numbers below the blot represent normalized fold change relative to non-treated control. (D) Tumor growth dynamics of LFS MB PDX models expressing WEE1 shRNA (shWEE1) and control shRNA (shSCRAMBLE). (E) Survival of mice injected with LFS MB PDX models expressing shWEE1 and shSCRAMBLE; log rank test was used for statistical analysis.

    Journal: iScience

    Article Title: Preclinical drug screen identifies WEE1 inhibitor and vinca alkaloid as a combination treatment concept for Li-Fraumeni syndrome medulloblastoma

    doi: 10.1016/j.isci.2025.114564

    Figure Lengend Snippet: In vivo validation of adavosertib and vincristine (VCR) in LFS SHH-MB models (A) Survival of mice injected with BT084 patient-derived xenograft (PDX) model during treatment with adavosertib and VCR; log rank test was used for statistical analysis. (B) Tumor growth dynamics of BT084 PDX model during treatment with adavosertib and vincristine (VCR): data are represented as mean ± SEM. (C) Phospho (p)-CDK1 in LFS SHH-MB PDX cells (HS231222 and LFS primary) following in vivo treatment with adavosertib and VCR: numbers below the blot represent normalized fold change relative to non-treated control. (D) Tumor growth dynamics of LFS MB PDX models expressing WEE1 shRNA (shWEE1) and control shRNA (shSCRAMBLE). (E) Survival of mice injected with LFS MB PDX models expressing shWEE1 and shSCRAMBLE; log rank test was used for statistical analysis.

    Article Snippet: LFS_primary cells transduced with shSCRAMBLE vector (Plasmid #1864, Addgene) were used as a negative control.

    Techniques: In Vivo, Biomarker Discovery, Injection, Derivative Assay, Control, Expressing, shRNA

    (A-B) Tumor spheroid invasion in collagen I matrix after (A) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or (B) treatment with MEL23. Representative images above and quantification below of area invaded and number of cells invading 24 h after implantation. (C-D) Tumor spheroid invasion in collagen I-BME matrix after (C) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or (D) treatment with MEL23. Representative images and quantification of area invaded 24 h after implantation. (E) Representative images of cell morphology of HT1080 p53KO cells transfected with siRNAs against Mdm2 or siCtrl in collagen matrix, 6 h after implantation. (F) Quantification of more circular cells (circularity of 0.75 or higher) in each condition shown in (E). (G-I) HT1080 p53KO cells stably expressing shRNA scramble (shScramble) or a pool of shRNAs against Mdm2 (shMdm2) were used to analyze metastatic burden using mouse models. (G) Protein levels of Mdm2 and MdmX in HT1080 shScramble and shMdm2 stable cell lines. β-actin was used as loading control. (H) Representative images above and quantification below of metastatic foci in the lungs after implantation of shScramble or shMdm2 cells using orthotropic model. (I) Representative images above and quantification below of metastatic foci in the lungs after injection of shScramble or shMdm2 cells using tail-vein model. Scale bars equivalent to 200 µm. Experiments shown represent mean ±SD of at least 3 biological replicates, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

    Journal: bioRxiv

    Article Title: Sprouty4 is required for Mdm2 regulation of invasion, focal adhesion formation and metastasis in cells lacking p53

    doi: 10.1101/2023.05.08.539890

    Figure Lengend Snippet: (A-B) Tumor spheroid invasion in collagen I matrix after (A) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or (B) treatment with MEL23. Representative images above and quantification below of area invaded and number of cells invading 24 h after implantation. (C-D) Tumor spheroid invasion in collagen I-BME matrix after (C) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or (D) treatment with MEL23. Representative images and quantification of area invaded 24 h after implantation. (E) Representative images of cell morphology of HT1080 p53KO cells transfected with siRNAs against Mdm2 or siCtrl in collagen matrix, 6 h after implantation. (F) Quantification of more circular cells (circularity of 0.75 or higher) in each condition shown in (E). (G-I) HT1080 p53KO cells stably expressing shRNA scramble (shScramble) or a pool of shRNAs against Mdm2 (shMdm2) were used to analyze metastatic burden using mouse models. (G) Protein levels of Mdm2 and MdmX in HT1080 shScramble and shMdm2 stable cell lines. β-actin was used as loading control. (H) Representative images above and quantification below of metastatic foci in the lungs after implantation of shScramble or shMdm2 cells using orthotropic model. (I) Representative images above and quantification below of metastatic foci in the lungs after injection of shScramble or shMdm2 cells using tail-vein model. Scale bars equivalent to 200 µm. Experiments shown represent mean ±SD of at least 3 biological replicates, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

    Article Snippet: Cells expressing shMdm2 or shScramble were sorted for GFP positive cells and transduced with lentivirus carrying a pool of shRNAs against Sprouty4 (4 different shRNAs purchased from OriGene, cat.#HC108594) or shScramble sequence as control (OriGene, cat.#TR30033).

    Techniques: Transfection, Stable Transfection, Expressing, shRNA, Control, Injection

    (A) The level of trapped PARP1 in HeLa cells treated with or without Talazoparib (10 μM for 72 hrs). Top, chromatin-bound fractions were isolated and were probed using the indicated antibodies. Histone H3 was used as the loading control. Bottom, the graph shows the quantification of the level of PARP1 trapping. Values were presented as means ± SD from three biological replicates. Significance was determined with unpaired Student’s t-test. ***p < 0.001. (B) Staining of cytosolic dsDNA in HeLa cells treated with or without Talazoparib (10 μM for 72 hrs). Left, representative image of PicoGreen (green) staining. DAPI (blue) was used to visualize the nucleus. Scale bars represent 10 μm. Right, the graph shows the quantification of the number of cells with cytosolic dsDNA. Values were presented as means ± SEM from three biological replicates (n = 3 fields, ≥ 100 cells counted per condition). Significance was *** determined with unpaired Student’s t-test. p < 0.0001. (C) The extent of DNA damage in HeLa cells treated with or without Talazoparib (10 μM for 72 hrs). Top, whole cell lysates were probed using the indicated antibodies. Bottom, the graph shows the quantification of γH2AX levels. Values were presented as means ± SD from three biological replicates. Significance was determined with unpaired Student’s t-test. **p < 0.01. (D) The level of pS172 TBK1 in HeLa cells treated with or without Talazoparib (10 μM for 72 hrs). Top, whole cell lysates were probed using the indicated antibodies. Bottom, the graph shows the quantification of pS172 TBK1 levels. Values were presented as means ± SD from three biological replicates. Significance was determined with unpaired Student’s t-test. **p < 0.01. (E) The level of pS396 IRF3 in HeLa cells treated with or without Talazoparib (10 μM for 72 hrs). Left, representative image of pS396 IRF3 levels (green). DAPI (blue) was used to visualize the nucleus. Scale bars represent 20 μm. Right, the graph shows the quantification of the number of cells stained positive for pS396 IRF3 in nucleus. Values were presented as means ± SEM from three biological replicates (n = 3 fields, ≥ 100 cells counted per condition). Significance was determined with unpaired Student’s t-test. ***p < 0.001. (F) RT-qPCR of type I interferons levels in HeLa cells treated with or without Talazoparib (10 μM for 72 hrs). Values of Inf-α and Inf-β were presented as means ± SEM from three biological replicates. Significance was determined with unpaired Student’s t-test. *p < 0.05, **p < 0.01. (G) Knock-down of cGAS. HeLa cells expressing the control shRNA (shScramble) or shcGAS (shcGAS #1 or #2) were probed using the indicated antibodies. Right, the graph shows the ratio of cGAS depletion. Values were presented as means ± SD from three biological replicates. Significance was determined with one-way ANOVA. ***p < 0.001. (H) Depletion of cGAS abolishes PARPi-induced activation of innate immune signaling. HeLa cells expressing shRNA against control (shScramble) or cGAS (shcGAS #1 or #2) were treated with or without Talazoparib (10 μM for 72 hrs). The cells were lysed and were immunoblotted using the indicated antibodies. Values were presented as means ± SD from three biological replicates. Significance was determined with two-way ANOVA. ****p < 0.0001, n.s., not significant. (I) RT-qPCR analyses of type I interferons. HeLa cells expressing shRNA against control (shScramble) or cGAS (shcGAS #1 or #2) were treated with or without Talazoparib (10 μM for 72 hrs). Values of Inf-α and Inf-β mRNA levels were presented as means ± SEM from three biological replicates. Significance was determined with unpaired Student’s t-test. ****p < 0.0001, n.s., not significant.

    Journal: bioRxiv

    Article Title: PARP1 inhibitors trigger innate immunity via PARP1 trapping-induced DNA damage response

    doi: 10.1101/2020.07.12.199349

    Figure Lengend Snippet: (A) The level of trapped PARP1 in HeLa cells treated with or without Talazoparib (10 μM for 72 hrs). Top, chromatin-bound fractions were isolated and were probed using the indicated antibodies. Histone H3 was used as the loading control. Bottom, the graph shows the quantification of the level of PARP1 trapping. Values were presented as means ± SD from three biological replicates. Significance was determined with unpaired Student’s t-test. ***p < 0.001. (B) Staining of cytosolic dsDNA in HeLa cells treated with or without Talazoparib (10 μM for 72 hrs). Left, representative image of PicoGreen (green) staining. DAPI (blue) was used to visualize the nucleus. Scale bars represent 10 μm. Right, the graph shows the quantification of the number of cells with cytosolic dsDNA. Values were presented as means ± SEM from three biological replicates (n = 3 fields, ≥ 100 cells counted per condition). Significance was *** determined with unpaired Student’s t-test. p < 0.0001. (C) The extent of DNA damage in HeLa cells treated with or without Talazoparib (10 μM for 72 hrs). Top, whole cell lysates were probed using the indicated antibodies. Bottom, the graph shows the quantification of γH2AX levels. Values were presented as means ± SD from three biological replicates. Significance was determined with unpaired Student’s t-test. **p < 0.01. (D) The level of pS172 TBK1 in HeLa cells treated with or without Talazoparib (10 μM for 72 hrs). Top, whole cell lysates were probed using the indicated antibodies. Bottom, the graph shows the quantification of pS172 TBK1 levels. Values were presented as means ± SD from three biological replicates. Significance was determined with unpaired Student’s t-test. **p < 0.01. (E) The level of pS396 IRF3 in HeLa cells treated with or without Talazoparib (10 μM for 72 hrs). Left, representative image of pS396 IRF3 levels (green). DAPI (blue) was used to visualize the nucleus. Scale bars represent 20 μm. Right, the graph shows the quantification of the number of cells stained positive for pS396 IRF3 in nucleus. Values were presented as means ± SEM from three biological replicates (n = 3 fields, ≥ 100 cells counted per condition). Significance was determined with unpaired Student’s t-test. ***p < 0.001. (F) RT-qPCR of type I interferons levels in HeLa cells treated with or without Talazoparib (10 μM for 72 hrs). Values of Inf-α and Inf-β were presented as means ± SEM from three biological replicates. Significance was determined with unpaired Student’s t-test. *p < 0.05, **p < 0.01. (G) Knock-down of cGAS. HeLa cells expressing the control shRNA (shScramble) or shcGAS (shcGAS #1 or #2) were probed using the indicated antibodies. Right, the graph shows the ratio of cGAS depletion. Values were presented as means ± SD from three biological replicates. Significance was determined with one-way ANOVA. ***p < 0.001. (H) Depletion of cGAS abolishes PARPi-induced activation of innate immune signaling. HeLa cells expressing shRNA against control (shScramble) or cGAS (shcGAS #1 or #2) were treated with or without Talazoparib (10 μM for 72 hrs). The cells were lysed and were immunoblotted using the indicated antibodies. Values were presented as means ± SD from three biological replicates. Significance was determined with two-way ANOVA. ****p < 0.0001, n.s., not significant. (I) RT-qPCR analyses of type I interferons. HeLa cells expressing shRNA against control (shScramble) or cGAS (shcGAS #1 or #2) were treated with or without Talazoparib (10 μM for 72 hrs). Values of Inf-α and Inf-β mRNA levels were presented as means ± SEM from three biological replicates. Significance was determined with unpaired Student’s t-test. ****p < 0.0001, n.s., not significant.

    Article Snippet: Briefly, lentiviral vectors (in pLKO.1) containing cGAS shRNA sequences (shcGAS #1, TRCN0000428336; shcGAS #2, TRCN0000149811) and non-target shRNA control vector (shScramble, SHC016) were purchased from Sigma.

    Techniques: Isolation, Staining, Quantitative RT-PCR, Expressing, shRNA, Activation Assay

    (A) RT-qPCR analyses of cGAS-STING target gene expression in HeLa cells treated with or without Talazoparib (10 μM for 72 hrs). Values of cytokines and ISGs mRNA levels were presented as means ± SEM from three biological replicates. Significance was determined with unpaired Student’s t-test. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. (B) The levels of trapped PARP1 in HeLa cells expressing shRNA against control (shScramble) or cGAS (shcGAS #1 or #2) that were treated with or without Talazoparib (10 μM for 72 hrs). Top, chromatin-bound fractions were isolated and were probed using the indicated antibodies. Histone H3 was used as the loading control. Bottom, the graph shows the quantification of the levels of PARP1 trapping. Values were presented as means ± SD from three biological replicates. Significance was determined with two-way ANOVA. ***p < 0.001, n.s., not significant. (C) The extent of DNA damage in HeLa cells expressing shRNA against control (shScramble) or cGAS (shcGAS #1 or #2) that were treated with or without Talazoparib (10 μM for 72 hrs). Top, whole cell lysates were probed using the indicated antibodies. Bottom, the graph shows the quantification of γH2AX levels. Values were presented as means ± SD from three biological replicates. Significance was determined with two-way ANOVA. ***p < 0.001, n.s., not significant. (D) RT-qPCR analyses of cGAS-STING target gene expression in HeLa cells expressing shRNA against control (shScramble) or cGAS (shcGAS #1 or #2) that were treated with or without Talazoparib (10 μM for 72 hrs). Values of cytokines and ISGs mRNA levels were presented as means ± SEM from three biological replicates. Significance was determined with two-way ANOVA. ***p < 0.001, ****p < 0.0001, n.s., not significant. (E) The levels of trapped PARP1 in MHH-ES-1 cells treated with or without Talazoparib (1 μM for 24 hrs). Top, chromatin-bound fractions were isolated and were probed using the indicated antibodies. Histone H3 was used as the loading control. Bottom, the graph shows the quantification of the level of PARP1 trapping. Values were presented as means ± SD from three biological replicates. Significance was determined with unpaired Student’s t-test. **p < 0.01. (F) The extent of DNA damage in MHH-ES-1 cells treated with or without Talazoparib (1 μM for 24 hrs). Top, whole cell lysates were probed using the indicated antibodies. Bottom, the graph shows the quantification of γH2AX levels. Values were presented as means ± SD from three biological replicates. Significance was determined with unpaired Student’s t-test. **p < 0.01. (G) The level of pS172 TBK1 in MHH-ES-1 cells treated with or without Talazoparib (1 μM for 24 hrs). Top, whole cell lysates were probed using the indicated antibodies. Bottom, the graph shows the quantification of pS172 TBK1 levels. Values were presented as means ± SD from three biological replicates. Significance was determined with unpaired Student’s t-test. **p < 0.01. (H) Reproducibility of the TMT experiments. The signal-to-noise (SN) values of the corresponding TMT channels for each protein was extracted from the two biological replicate experiments. (I) Quantification of protein expression in MHH-ES-1 cells treated with Talazoparib 1 μM for 24 hrs (Table S1). Top, the graph shows the log 2 value of total protein expression in Talazoparib-treated vs. DMSO control. Bottom, the heatmap shows quantification reproducibility of the up- and down-regulated protein. Red: up-regulated proteins; Green: down-regulated proteins. (J) GO analysis of the up-regulated proteins as shown in . The list shows the top 10 enriched biological processes of the up-regulated proteins. (K) RT-qPCR analyses of the cGAS-STING target gene expression in MHH-ES-1 cells treated with or without Talazoparib (1 μM for 24 hrs). Values of type I interferons, cytokines, and ISGs mRNA levels were presented as means ± SEM from three biological replicates. Significance was determined with unpaired Student’s t-test. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

    Journal: bioRxiv

    Article Title: PARP1 inhibitors trigger innate immunity via PARP1 trapping-induced DNA damage response

    doi: 10.1101/2020.07.12.199349

    Figure Lengend Snippet: (A) RT-qPCR analyses of cGAS-STING target gene expression in HeLa cells treated with or without Talazoparib (10 μM for 72 hrs). Values of cytokines and ISGs mRNA levels were presented as means ± SEM from three biological replicates. Significance was determined with unpaired Student’s t-test. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. (B) The levels of trapped PARP1 in HeLa cells expressing shRNA against control (shScramble) or cGAS (shcGAS #1 or #2) that were treated with or without Talazoparib (10 μM for 72 hrs). Top, chromatin-bound fractions were isolated and were probed using the indicated antibodies. Histone H3 was used as the loading control. Bottom, the graph shows the quantification of the levels of PARP1 trapping. Values were presented as means ± SD from three biological replicates. Significance was determined with two-way ANOVA. ***p < 0.001, n.s., not significant. (C) The extent of DNA damage in HeLa cells expressing shRNA against control (shScramble) or cGAS (shcGAS #1 or #2) that were treated with or without Talazoparib (10 μM for 72 hrs). Top, whole cell lysates were probed using the indicated antibodies. Bottom, the graph shows the quantification of γH2AX levels. Values were presented as means ± SD from three biological replicates. Significance was determined with two-way ANOVA. ***p < 0.001, n.s., not significant. (D) RT-qPCR analyses of cGAS-STING target gene expression in HeLa cells expressing shRNA against control (shScramble) or cGAS (shcGAS #1 or #2) that were treated with or without Talazoparib (10 μM for 72 hrs). Values of cytokines and ISGs mRNA levels were presented as means ± SEM from three biological replicates. Significance was determined with two-way ANOVA. ***p < 0.001, ****p < 0.0001, n.s., not significant. (E) The levels of trapped PARP1 in MHH-ES-1 cells treated with or without Talazoparib (1 μM for 24 hrs). Top, chromatin-bound fractions were isolated and were probed using the indicated antibodies. Histone H3 was used as the loading control. Bottom, the graph shows the quantification of the level of PARP1 trapping. Values were presented as means ± SD from three biological replicates. Significance was determined with unpaired Student’s t-test. **p < 0.01. (F) The extent of DNA damage in MHH-ES-1 cells treated with or without Talazoparib (1 μM for 24 hrs). Top, whole cell lysates were probed using the indicated antibodies. Bottom, the graph shows the quantification of γH2AX levels. Values were presented as means ± SD from three biological replicates. Significance was determined with unpaired Student’s t-test. **p < 0.01. (G) The level of pS172 TBK1 in MHH-ES-1 cells treated with or without Talazoparib (1 μM for 24 hrs). Top, whole cell lysates were probed using the indicated antibodies. Bottom, the graph shows the quantification of pS172 TBK1 levels. Values were presented as means ± SD from three biological replicates. Significance was determined with unpaired Student’s t-test. **p < 0.01. (H) Reproducibility of the TMT experiments. The signal-to-noise (SN) values of the corresponding TMT channels for each protein was extracted from the two biological replicate experiments. (I) Quantification of protein expression in MHH-ES-1 cells treated with Talazoparib 1 μM for 24 hrs (Table S1). Top, the graph shows the log 2 value of total protein expression in Talazoparib-treated vs. DMSO control. Bottom, the heatmap shows quantification reproducibility of the up- and down-regulated protein. Red: up-regulated proteins; Green: down-regulated proteins. (J) GO analysis of the up-regulated proteins as shown in . The list shows the top 10 enriched biological processes of the up-regulated proteins. (K) RT-qPCR analyses of the cGAS-STING target gene expression in MHH-ES-1 cells treated with or without Talazoparib (1 μM for 24 hrs). Values of type I interferons, cytokines, and ISGs mRNA levels were presented as means ± SEM from three biological replicates. Significance was determined with unpaired Student’s t-test. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

    Article Snippet: Briefly, lentiviral vectors (in pLKO.1) containing cGAS shRNA sequences (shcGAS #1, TRCN0000428336; shcGAS #2, TRCN0000149811) and non-target shRNA control vector (shScramble, SHC016) were purchased from Sigma.

    Techniques: Quantitative RT-PCR, Expressing, shRNA, Isolation